Metallothionein-1A
Details
- Name
- Metallothionein-1A
- Synonyms
- Metallothionein-IA
- MT-1A
- MT-IA
- MT1S
- Gene Name
- MT1A
- Organism
- Humans
- Amino acid sequence
>lcl|BSEQ0013312|Metallothionein-1A MDPNCSCATGGSCTCTGSCKCKECKCTSCKKSCCSCCPMSCAKCAQGCICKGASEKCSCC A
- Number of residues
- 61
- Molecular Weight
- 6120.19
- Theoretical pI
- Not Available
- GO Classification
- Functionszinc ion bindingProcessescellular response to cadmium ion / cellular response to zinc ion / negative regulation of growthComponentscytoplasm / nucleus / perinuclear region of cytoplasm
- General Function
- Zinc ion binding
- Specific Function
- Metallothioneins have a high content of cysteine residues that bind various heavy metals; these proteins are transcriptionally regulated by both heavy metals and glucocorticoids.
- Pfam Domain Function
- Metallothio (PF00131)
- Transmembrane Regions
- Not Available
- Cellular Location
- Not Available
- Gene sequence
>lcl|BSEQ0013313|Metallothionein-1A (MT1A) ATGGACCCCAACTGCTCCTGCGCCACTGGTGGCTCCTGCACCTGCACTGGCTCCTGCAAA TGCAAAGAGTGCAAATGCACCTCCTGCAAGAAGAGCTGCTGCTCCTGCTGCCCCATGAGC TGTGCCAAGTGTGCCCAGGGCTGCATCTGCAAAGGGGCATCAGAGAAGTGCAGCTGCTGT GCCTGA
- Chromosome Location
- 16
- Locus
- Not Available
- External Identifiers
Resource Link UniProtKB ID P04731 UniProtKB Entry Name MT1A_HUMAN HGNC ID HGNC:7393 - General References
- Richards RI, Heguy A, Karin M: Structural and functional analysis of the human metallothionein-IA gene: differential induction by metal ions and glucocorticoids. Cell. 1984 May;37(1):263-72. [Article]
- Martin J, Han C, Gordon LA, Terry A, Prabhakar S, She X, Xie G, Hellsten U, Chan YM, Altherr M, Couronne O, Aerts A, Bajorek E, Black S, Blumer H, Branscomb E, Brown NC, Bruno WJ, Buckingham JM, Callen DF, Campbell CS, Campbell ML, Campbell EW, Caoile C, Challacombe JF, Chasteen LA, Chertkov O, Chi HC, Christensen M, Clark LM, Cohn JD, Denys M, Detter JC, Dickson M, Dimitrijevic-Bussod M, Escobar J, Fawcett JJ, Flowers D, Fotopulos D, Glavina T, Gomez M, Gonzales E, Goodstein D, Goodwin LA, Grady DL, Grigoriev I, Groza M, Hammon N, Hawkins T, Haydu L, Hildebrand CE, Huang W, Israni S, Jett J, Jewett PB, Kadner K, Kimball H, Kobayashi A, Krawczyk MC, Leyba T, Longmire JL, Lopez F, Lou Y, Lowry S, Ludeman T, Manohar CF, Mark GA, McMurray KL, Meincke LJ, Morgan J, Moyzis RK, Mundt MO, Munk AC, Nandkeshwar RD, Pitluck S, Pollard M, Predki P, Parson-Quintana B, Ramirez L, Rash S, Retterer J, Ricke DO, Robinson DL, Rodriguez A, Salamov A, Saunders EH, Scott D, Shough T, Stallings RL, Stalvey M, Sutherland RD, Tapia R, Tesmer JG, Thayer N, Thompson LS, Tice H, Torney DC, Tran-Gyamfi M, Tsai M, Ulanovsky LE, Ustaszewska A, Vo N, White PS, Williams AL, Wills PL, Wu JR, Wu K, Yang J, Dejong P, Bruce D, Doggett NA, Deaven L, Schmutz J, Grimwood J, Richardson P, Rokhsar DS, Eichler EE, Gilna P, Lucas SM, Myers RM, Rubin EM, Pennacchio LA: The sequence and analysis of duplication-rich human chromosome 16. Nature. 2004 Dec 23;432(7020):988-94. [Article]
- Gerhard DS, Wagner L, Feingold EA, Shenmen CM, Grouse LH, Schuler G, Klein SL, Old S, Rasooly R, Good P, Guyer M, Peck AM, Derge JG, Lipman D, Collins FS, Jang W, Sherry S, Feolo M, Misquitta L, Lee E, Rotmistrovsky K, Greenhut SF, Schaefer CF, Buetow K, Bonner TI, Haussler D, Kent J, Kiekhaus M, Furey T, Brent M, Prange C, Schreiber K, Shapiro N, Bhat NK, Hopkins RF, Hsie F, Driscoll T, Soares MB, Casavant TL, Scheetz TE, Brown-stein MJ, Usdin TB, Toshiyuki S, Carninci P, Piao Y, Dudekula DB, Ko MS, Kawakami K, Suzuki Y, Sugano S, Gruber CE, Smith MR, Simmons B, Moore T, Waterman R, Johnson SL, Ruan Y, Wei CL, Mathavan S, Gunaratne PH, Wu J, Garcia AM, Hulyk SW, Fuh E, Yuan Y, Sneed A, Kowis C, Hodgson A, Muzny DM, McPherson J, Gibbs RA, Fahey J, Helton E, Ketteman M, Madan A, Rodrigues S, Sanchez A, Whiting M, Madari A, Young AC, Wetherby KD, Granite SJ, Kwong PN, Brinkley CP, Pearson RL, Bouffard GG, Blakesly RW, Green ED, Dickson MC, Rodriguez AC, Grimwood J, Schmutz J, Myers RM, Butterfield YS, Griffith M, Griffith OL, Krzywinski MI, Liao N, Morin R, Palmquist D, Petrescu AS, Skalska U, Smailus DE, Stott JM, Schnerch A, Schein JE, Jones SJ, Holt RA, Baross A, Marra MA, Clifton S, Makowski KA, Bosak S, Malek J: The status, quality, and expansion of the NIH full-length cDNA project: the Mammalian Gene Collection (MGC). Genome Res. 2004 Oct;14(10B):2121-7. [Article]
Drug Relations
- Drug Relations
DrugBank ID Name Drug group Pharmacological action? Actions Details DB00515 Cisplatin approved unknown substrate Details DB00958 Carboplatin approved unknown substrate Details DB00526 Oxaliplatin approved, investigational no substrate Details DB00435 Nitric Oxide approved unknown Details DB01593 Zinc approved, investigational unknown Details DB14487 Zinc acetate approved, investigational unknown Details DB14533 Zinc chloride approved, investigational unknown binder Details DB14548 Zinc sulfate, unspecified form approved, experimental unknown binder Details DB09130 Copper approved, investigational no binder Details DB12965 Silver approved, investigational unknown binder Details